Trop Team
Search Khokha Lab site
Google Custom Search
Obtain Embryos
Genomic Resources
Trop Labs
Journals - Library
Other

Harland Lab Trop Plasmid Library

To obtain clones, email harland@socrates.berkeley.edu

Note: Due to a MTA, clones that are from the Wellcome Trust and sequenced by the Sanger are available at Geneservice. The clone ID begins with Tneu, Tegg, or Tgas. We cannot distribute these clones so please obtain them from the Geneservice.

Last updated 10/27/05

Please use the find command in your browser to search for clones

Plasmid name Record number Other names Vector Purpose and notes Antisense
a-tubulin 269 alpha tubulin pCMV-SPORT6.1 BC061297
Xenopus tropicalis tubulin, alpha 1, mRNA (cDNA clone MGC:75767 IMAGE:5381815), complete cds
gi|38511929|gb|BC061297.1|[38511929]
internal RI/notI site

a1-ATPasea 250 a1-ATPase alpha1-ATPase Na/K ATPase a1 subunit endoderm pCMV-SPORT6.1 dbEST Id: 19434432
EST name: AGENCOURT_15040604
GenBank Acc: CF220660
GenBank gi: 33421368

CLONE INFO
Clone Id: IMAGE:6988026 (5')
KpnI/T7*
Activin beta b subunit 196 activin CS107 Tneu142F12
ADMP1 304 ADMP CS107 CS107 prepped version of clone Tgas066c03
sequenced 6/24/05

Do NOT use:
Ecor1
bamH1
hindIII
XbaI
T7 Cla1
ADMP1/pcmv 305
pCMV Sport 6.1 sequence confirmed 6/24/05
prep of Image clone 6990706, intended for subcloning into CS108 for probe/mRNA
can also use record #304 for same purpose


ADMP2 290 ADMP2 CS107 CS107 this is a prep from ordered clone number Tneu087d02.
sequence verified
in situ pattern is faint; anterior neural.

T7/BamH1
alpha tubulin 181 tubulin a-tubulin alpha tubulin pCMV-sport6.1 >gi|33245881|gb|CF149613.1|CF149613 AGENCOURT_14929401 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone
IMAGE:6980422 5'.

We thought this was gridlock but seq. confirms that it is tubulin
kpnI/T7
ap2 210 ap2 ap-2 CS107 Tgas030K20 claI/T7
Axial protocadherin 137 apc axial protocadherin CS107 Tegg092J24
3' end not all there
EcoRI/T7*
Axial protocadherin 139 apc axial protocadherin CS107 Tegg017F14 EcoRI/T7
Axin related 199 axin related CS107 Tneu129J09
The first few nucleotides may be missing in this clone - just short of full length

BAMBI 195 bambi CS107 Tegg028M12 T7/ClaI*
BAMBI 198
CS107 TEgg127M13 T7/ClaI
beta-catenin 236 beta-catenin b-catenin catenin CS107

BMP2 202 bmp2 bmp-2 bone morphogenetic protein 2 CS107 Tegg105I19 T7/ClaI*
BMP2 207 bmp2 bmp-2 CS107 Tgas025A06
BMP4 193 bmp-4 bmp4 bone morphogenetic protein4 CS107 Tneu045C17

This clone has a very short insert.
T7/ClaI
BMP4 194 bmp-4 bmp4 bone morphogenetic protein4 CS107 Tneu059F22

This clone also has a very short insert
T7/ClaI
BMP4 212 bmp 4 bmp-4 bmp4 bone morphogenetic protein CS107 Tneu015d14 claI/t7
bmp4 231 bmp4 bmp-4 bone morphogenetic protein CS107 Tgas125E13 claI/T7
BMP7 61 BMP BMP-7 BMP7 bmp7 bmp-7 bmp-7R CS107 Genbank ID#BG514944


bamH1 (t7) ok as well - NOT hind III
*this clone has been tested and works for in situ

This clone encodes a protein more similar to "BMP-7R" of X. laevis than to "BMP-7," see Wang et al. 1997, Genes and Function for comparison of proteins.
see also clone 306 "BMP7-new"
RI/T7*
BMP7 new 306 BMP7 pCMV, pCMV sport 6.1 prepped version of IMAGE 5384686.
this is a better match to the "real" BMP7 (see Wang, Moos 1997, Genes and Function) than our clone #61 BMP7 (BMP7R).
This has been CS110K, record #310, but 306 also makes a fine probe
sequence confirmed 6/24/05
do NOT use Ecor1
T7/kpn1
BMP7-CS110K 310 BMP7 CS110K this is the "real" BMP7 of record 306 subcloned into Maura's 110K vector.
Kanamycin selection!!
do not use not1
do not use
(some restriction sites are inverted vs. record 306 following recombination reaction)
T7
C3 246 Complement C3 edoderm pCMV-SPORT6.1 dbEST Id: 19453773
EST name: AGENCOURT_15100521
GenBank Acc: CF239870
GenBank gi: 33443078

CLONE INFO
Clone Id: IMAGE:6994794 (5')

Cart-1 291 cart1 cart-1 cartilage pCMVsport6 LOCUS CX939893 849 bp mRNA linear EST 07-FEB-2005
DEFINITION JGI_CAAO6836.fwd NIH_XGC_tropTe5 Xenopus tropicalis cDNA clone
IMAGE:7703480 5', mRNA sequence.
ACCESSION CX939893
VERSION CX939893.1 GI:58729651

Site_1: SalI; Site_2: NotI;
KpnI/T7
Cerberus 21 Cerberus cerberus CS107 LIG10F05
AL638969
T7/BamH1 *(not Ecor1)
Cerberus 36 cerberus Cerberus CERBERUS CS107 Tgas016C17 T7 BamH1 (not Ecor1)
Ches1 163 fkhd forkhead fox ches1 FoxN3 CS107 Tgas027E12
Chito 242 Chito endoderm Glycosyl hydrolases / di-N-acetylchitobiase pExpress-1 dbEST Id: 19634136
EST name: AGENCOURT_15324914
GenBank Acc: CF375459
GenBank gi: 34312903

CLONE INFO
Clone Id: IMAGE:7007227 (5')

For vector information see
http://zgc.nci.nih.gov/Vectors/vec_pexpress-1
For probe XmaI,EcoRI, RsrII T7

Chordin 1 Chordin chordin CS107 Tgas122K5
Chordin 3 Chordin chordin CS107 Tgas133K5 T7 Ecor1
Chordin 4 Chordin chordin CS107 Tgas083F21 T7 Ecor1
Chordin 6 Chordin chordin CS107 Tneu011C22 T7 Ecor1*
Chordin 7 Chordin chordin CS107 Tneu140P12 T7 Ecor1
Chordin 13 Chordin chordin CS107 Tneu029D7 T7 not R1 - use Bamh1
Chordin 14 Chordin chordin CS107 Tneu033C4 T7 Ecor1
Chordin 16 Chordin chordin CS107 Tneu005F12 T7 Ecor1
Chordin 19 Chordin chordin CS107 Tneu080L20 T7 Ecor1
Churchill 222 churchill CS107 TTpA047h20 BamHI/T7*
Collagen A Type II 288 Collagen II A pCMV-SPORT6.1 ACCESSION BC063191
full length sequence available
AgeI/T7
Coronin 55 coronin CS107 Genbank ID# BG512194
dad26g11.y1 Wellcome CRC pCS107 tropicalis St10-12 Silurana tropicalis cDNA clone IMAGE:4440788 5' similar to TR:Q9PWG8 Q9PWG8 CORONIN HOMOLOG. ;, MRNA sequence

cpl1 235 cpl1 cpl-1 lipocalin CS107 Cloned into assymetric SfI I sites. 5' EcorI NotI 3'

for probes linearize with EcoRI or Kpn I
T7/KpnI
Crescent 150 crescent frzb2 frzb-2 CS107 Tneu117G19 claI/T7
Crescent 151 crescent frzb2 frzb-2 CS107 Tneu018n22
3' end appears to be chimeric with translation initiation factor

Crescent 152 crescent frzb2 frzb-2 CS107 Tneu142G13
cytokeratin 270 cytokeratin epidermal keratin pCMV-SPORT6.1 EST name: AGENCOURT_15113715
GenBank Acc: CF240450
GenBank gi: 33443658

CLONE INFO
Clone Id: IMAGE:6991625 (3')
EcoRI/T7
cytokeratin 271 cytokeratin epidermal keratin pCMV-SPORT6.1 dbEST Id: 19309082
EST name: AGENCOURT_14905694
GenBank Acc: CF152092
GenBank gi: 33248600

CLONE INFO
Clone Id: IMAGE:6984581 (5')

Dazap2 96 Dazap-2 dazap2 proline-rich protein, 81E10 CS107
ClaI/T7
delta 281 delta sport6 Image clone 6988912 t7/kpn1
derriere 69 derriere CS107 Tgas141F11
*tested for in situ - works
RI/T7*
DG42 247 Hyaluronan synthase 1 DG42 endoderm pCMV-SPORT6.1 dbEST Id: 19434270
EST name: AGENCOURT_15041124
GenBank Acc: CF220501
GenBank gi: 33421209

CLONE INFO
Clone Id: IMAGE:6988222 (5')

dHAND 277 dHAND pCMV-SPORT6.1
EST name: AGENCOURT_14980561
GenBank Acc: CF218564
GenBank gi: 33419272

CLONE INFO
Clone Id: IMAGE:6989521 (5')

Dickkopf-1 2 Dickkopf-1 dickkopf1 dkk CS107 Tgas131C10 T7/R1*
BamH1 and HindIII ok too
DLL2 120 xdll2 dll DLL CS107 Likely have 3'
Don't have 5'
TGAS040e17

dll2 125 dll-2 DLL xdll2 CS107 no 5'
3' - not sure
TNeu022006
claI/T7
DLL3 116 dll3 dll CS107 don't have 5'
TNeu139d17
claI/T7
dlx2 307 dlx-2 pCMV-SPORT6.1 LOCUS NM_001008060 2508 bp DEFINITION Xenopus tropicalis dlx2-prov protein (dlx2-prov), mRNA.
ERSION NM_001008060.1 GI:56118495
LOCUS BC080947 2508 bp mRNA linear VRT 08-MAR-2005
DEFINITION Xenopus tropicalis dlx2-prov protein, mRNA (cDNA clone MGC:79639
IMAGE:6980076), complete cds.
ACCESSION BC080947 GI:51704086
Vector: pCMV-SPORT6.1; Site_1: NotI; Site_2: EcoRV;

EF1alpha 103
CS108

Emx1 251 emx1 empty spiracles 1 forebrain pCMV-SPORT6.1 LOCUS BC074580 1377 bp mRNA linear VRT 25-JUN-2004
DEFINITION Xenopus tropicalis cDNA clone MGC:69381 IMAGE:5335247, complete
cds.

EST name: NISC_nl02b12.y1
GenBank Acc: BQ520008
GenBank gi: 21378877

CLONE INFO
Clone Id: IMAGE:5335247 (5'
Kpn1/T7*
emx1 254 emx-1 emx1 CS107 TNeu052k18

gi|38337578|gb|BX688458.1|BX688458 BX688458 XGC-neurula
Xenopus tropicalis cDNA clone TNeu052k18 3', mRNA sequence

emx2 255 emx-2 emx2 CS107 I am not sure which one.

gi|48676054|gb|CR407807.1|CR407807 CR407807 XGC-tailbud
Xenopus tropicalis cDNA clone TTbA001k13 5', mRNA sequence
Query= gi|38311649|gb|AL789146.2|AL789146 AL789146 XGC-neurula
Xenopus tropicalis cDNA clone TNeu125h20 5', mRNA sequence
claI/T7
emx3 188 emx3 pCMV-sport6.1 uncertain if emx1 or emx2


AGENCOURT_15065581 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone IMAGE:6978117 3', MRNA sequence
gi|33425498|gb|CF224790.1|[33425498]


AGENCOURT_15066333 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone IMAGE:6978117 5', MRNA sequence
gi|33425497|gb|CF224789.1|[33425497]

Asp718/T7*
En-1 318 engrailed1 engrailed-1 en1 en-1 PCR2.1 topo ~1000 bp PCR fragment was amplified and cloned using the TOPO TA kit into HindIII/T7
En-2 154 engrailed-2 en2 pCRII-TOPO 3950 nt an en-2 probe was amplified using the primers TGGGGAAGGAGATGCTTTGC
and TGGGCTGCTGAGAGGTTTTG.

pCRII-Topo also has a kanR cassette.

speI/T7*
Endocut 244 endocut Glutamate carboxypeptidase M20 endoderm pCMV-SPORT6.1 dbEST Id: 19435911
EST name: AGENCOURT_14995193
GenBank Acc: CF222137
GenBank gi: 33422845

CLONE INFO
Clone Id: IMAGE:6986243 (5')

Endodermin 100 edd endodermin pCMV-SPORT6.ccdb dbEST Id: 12638199
EST name: NISC_no19b07.y1
GenBank Acc: BQ526904
GenBank gi: 21385773

CLONE INFO
Clone Id: IMAGE:5381340 (5')
Source: IMAGE Consortium, LLNL


Endodermin 109 endodermin, edd CS107 dbEST Id: 12638199
EST name: NISC_no19b07.y1
GenBank Acc: BQ526904
GenBank gi: 21385773

CLONE INFO
Clone Id: IMAGE:5381340 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11971 Row: D Column: 13

Endodermin 219 endodermin pCMV-SPORT6.1
EST name: AGENCOURT_14928500
GenBank Acc: CF149137
GenBank gi: 33245405

CLONE INFO
Clone Id: IMAGE:6978356 (5')

antisense try RI or kpnI T7

Endothelin-1 287 entdothelin-1 endothelin1 CS107 TTpa039J07
Eomesodermin 204 eomesodermin CS107 Tgas141F06 RI/T7*
Eomesodermin 205 eomesodermin CS107 Tgas015D23
3' end gives no hits

Eph receptor tyrosine kinase 186 eph CS107 TGas045P01 ClaI/T7
EphB4 184 vascular ephb4 CS107 Tgas046K17 claI/T7*
EphB4 185 vascular ephb4 CS107 TNeu111K19 ClaI/T7
Ephrin b2 237 ephrin b2 pCMV-SPORT6.1 dbEST Id: 12435154
EST name: NISC_mq12f01.y1
GenBank Acc: BQ390329
GenBank gi: 21078016

CLONE INFO
Clone Id: IMAGE:5308177 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11780 Row: L Column: 2

EphrinB2 179 ephrin ephrinB2 ephrin-B2 pCMV-sport6.1 NISC_mq03c02.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5307266 5', MRNA sequence
gi|21076361|gb|BQ388674.1|[21076361]

NISC_mq03c02.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5307266 3', MRNA sequence
gi|21076360|gb|BQ388673.1|[21076360]

Asp718/T7
Epidermal Keratin 101 epidermal keratin keratin epidermis CS108 insert cloned into sal I-Not I
esr4 70 ESR4 esr CS107 Likely have 3'
Don't have 5'
TNeu125H16

ESR4 119 esr4 Esr4 CS107 5' not present
TNEU138e11

Fast1 164 fkhd forkhead fox Fast1 FoxH3 CS107 Tegg015N21
Fetuinish 249 Fetuinish Cystatin protease inhibitor / Fetuin-b endoderm pExpress-1 dbEST Id: 19889197
EST name: AGENCOURT_15703449
GenBank Acc: CF593173
GenBank gi: 36346442

CLONE INFO
Clone Id: IMAGE:7025331 (5')

FGF-8 220 fgf-8 fgf8 fibroblast growth factor 8 fgf pCMV-SPORT6.1 dbEST Id: 19308323
EST name: AGENCOURT_14904188
GenBank Acc: CF151333
GenBank gi: 33247841

CLONE INFO
Clone Id: IMAGE:6983047 (5')

antisense try RI or kpnI T7

FGF8 90 FGF8 fibroblast growth factor fgf-8 CS107 Tneu007i10
FGF8 95 fgf-8 fgf8 fibroblast growth factor CS107 TNeu007I10

*Been tested and works on in situ
T7/R1*
FGFR1 80 FGFR1 fibroblast growth factor receptor FGFR-1 CS107 Tneu049H18
FGFR2 77 FGFR2 FGFR fibroblast growth factor receptor FGFR-2 CS107 Tgas066A10
fgfr2 115 fibroblast growth factor receptor-2 fgfr CS107 AL637435
Don't have 5'
Clone Lig8c12

fgfr2 122 fgfr2 fibroblast growth factor receptor 2 fgfr-2 CS107 No 5'
TGas066a10

FGFR4a 87 FGFR4a fibroblast growth factor receptor FGFR-4a CS107 Tgas028m19
Fibronectin 64 fibronectin CS107 Genbank accession #BG886270
Fkh5 73 Fkh5 foxb1 forkhead5 forkhead-5 fkh-5 CS107 Tgas064p06
Fkh5 84 Fkh5 forkhead5 forkhead-5 fkh-5 CS107 Tgas053m03
Fkh6 83 fkh6 foxD3 forkhead6 forkhead-6 fkh-6 XFD6 CS107 Tgas035o17
Fli 302 fli vascular pCS108 DEFINITION JGI_XZT46477.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone
IMAGE:7621709 5', mRNA sequence.
ACCESSION CX342033
VERSION CX342033.1 GI:57078505
Site_1: SalI; Site_2: NotI

flk-1 294 flk1 vasciular flk-1 pCS108 DEFINITION JGI_XZT45538.fwd NIH_XGC_tropTad5 Xenopus tropicalis cDNA clone
IMAGE:7620420 5', mRNA sequence.
ACCESSION CX341075
VERSION CX341075.1 GI:57077547

Site_1: SalI; Site_2: NotI;

follistatin 68 follistatin CS107 dad17g05.y1 Wellcome CRC pCS107 tropicalis St10-12 Silurana tropicalis cDNA clone IMAGE:4439985 5' similar to TR:Q91376 Q91376 FOLLISTATIN. ;.

BG348597
T7 Bamh1*(not R1)
forkhead 157 fkhd forkhead fox CS107 Tgas019F24
This clone has weak similarity to XFD2 (FoxI1a)

forkhead 175 fkhd forkhead fox

CS107 Tgas019F21
weak similarity to XFD2

Forkhead box I1 176 fkhd forkhead foxI1 pCMV-sport6.1 NISC_ng06a02.y1 NICHD_XGC_Emb6 Silurana tropicalis cDNA clone IMAGE:5382411 5', MRNA sequence
gi|21081568|gb|BQ393881.1|[21081568]


Foxa2 136 fox foxa2 hnf3b hnf3beta hnf CS107 Tneu069I04 ClaI/T7*
FoxD3 216 foxd3 CS107 dbEST Id: 19434281
EST name: AGENCOURT_15040932
GenBank Acc: CF220512
GenBank gi: 33421220

CLONE INFO
Clone Id: IMAGE:6988210 (5'
SalI/T7
FoxI1 166 fkhd forkhead foxi1 XFD2 CS107 Tegg136P02
FoxI1 171 fkhd forkhead foxI1 XFD2 CS107 Tneu084P05
FoxI1a 23 xFD2 fox FoxI1a CS107 Tneu012H23 T7 Ecor1
FoxI1a 32 xFD2 fox FoxI1a CS107 Tgas002H16
Maybe have 5' of gene also

*this clone has been tested and works for in situ
T7 BamHI*
FoxI1c 162 FoxI1c fkhd forkhead fox XFD10 CS107 Tgas113F01
Foxi3 161 FoxI3 fkhd forkhead fox CS107 Tegg138H22
most similar to foxi3

Foxi3 169 fkhd forkhead foxi3 CS107 Tegg020K15
FoxJ1 173 fkhd forkhead foxJ1 pCMV-sport6.1 NISC_mq24c11.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 5', MRNA sequence
gi|21080102|gb|BQ392415.1|[21080102]

NISC_mq24c11.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 3', MRNA sequence
gi|21080101|gb|BQ392414.1|[21080101]


FoxJ1 191 fkhd foxj1 pCMV-SPORT6.1 NISC_mq24c11.y1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 5', MRNA sequence
gi|21080102|gb|BQ392415.1|[21080102]

NISC_mq24c11.x1 NICHD_XGC_Emb5 Silurana tropicalis cDNA clone IMAGE:5309205 3', MRNA sequence
gi|21080101|gb|BQ392414.1|[21080101]


FoxJ2 174 fkhd forkhead fox J2 pCMV-sport6.1 NISC_nl03a03.y1 NICHD_XGC_Emb7 Silurana tropicalis cDNA clone IMAGE:5335204 5', MRNA sequence
gi|21378989|gb|BQ520120.1|[21378989]


FoxN4 172 fkhd forkhead foxN4 CS107 Tegg019G15
Foxq1 167 fkhd forkhead foxq1 CS107 Tneu015L12
Frzb 65 Frzb CS107 Genbank Accession #BG886039
not BamH1 - HindIII or R1 OK
RI/T7*
Frzb 72 Frzb fzb CS107 Tgas069i22
Frzb 74 Fzb frzb CS107 Tneu037b10
Fugacin 53 fugacin xnr3 xnr nodal related 3 CS107 see Genbank ID# BG886280
dad51c07.x1 Wellcome CRC pCS107 tropicalis St10-12 Silurana tropicalis cDNA clone IMAGE:4462861 3' similar to TR:Q91621 Q91621 FUGACIN. ;, MRNA sequence
gi|14263370|gb|BG886280.1|[14263370]
T7 Cla1
Gata-4 258 gata4 gata-4 CS107 TGas120j19
gi|38703057|gb|AL960651.2|AL960651 AL960651 XGC-gastrula
Xenopus tropicalis cDNA clone TGas120j19 5

Gata-4 259 gata4 gata-4 CS107 TGas112g01
gi|39015137|gb|AL963806.2|AL963806 AL963806 XGC-gastrula
Xenopus tropicalis cDNA clone TGas112g01 5', mRNA sequence

gata-5 245 gata5 gata-5 endoderm pCMV-SPORT6.1 dbEST Id: 19434277
EST name: AGENCOURT_15040996
GenBank Acc: CF220508
GenBank gi: 33421216

CLONE INFO
Clone Id: IMAGE:6988214 (5')

Gata-6 67 gata gata6 gata- 6 CS107 Genbank #BG885303
Gata4 108 gata gata4 gata-4 CS107 TNeu111a24 BamHI/T7
Gata6 110 gata gata-6 pCMV-sport6.1 dbEST Id: 12441064
EST name: NISC_ng19g04.y1
GenBank Acc: BQ396239
GenBank gi: 21083926

CLONE INFO
Clone Id: IMAGE:5383878 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11977 Row: N Column: 7
KpnI/T7
gata6 111 gata gata-6 pCMV-SPORT6.1 dbEST Id: 12440736
EST name: NISC_ng17h04.y1
GenBank Acc: BQ395911
GenBank gi: 21083598

CLONE INFO
Clone Id: IMAGE:5383902 (5')
Source: IMAGE Consortium, LLNL
Plate: LLAM11977 Row: O Column: 7

Gata6 257 gata-6 gata6 pCMV-SPORT6.1 dbEST Id: 12441064
EST name: NISC_ng19g04.y1
GenBank Acc: BQ396239
GenBank gi: 21083926

CLONE INFO
Clone Id: IMAGE:5383878 (5')
claI/T7
Gata6 264 gata-6 gata6 pCMV-SPORT6.1 dbEST Id: 12440736
EST name: NISC_ng17h04.y1
GenBank Acc: BQ395911
GenBank gi: 21083598

CLONE INFO
Clone Id: IMAGE:5383902 (5')

Gbx 2 89 Gbx 2 gbx-2 gbx2 CS107 Tneu059g14
Gbx2 82 Gbx-2 Gbx2 CS107 Tgas027p15
gbx2 121 gbx2b gbx CS107 No 5'
Likely have 3'
TGas037A13

Probe Made*
*ClaI/T7
GDF6 CS107 289 GDF6 CS107 this is just a prepped version of clone Tgas137g21 from Russell's library.
sequence verified
In situ pattern matches published pattern for laevis (Chang and Hemmati-Brivanlou 1999), probe takes a couple days at 4 degrees to come up.
<